BSU22880

BSU_22880

1146

1149

BSU22880

BSU_22880

2,394,664 → 2,395,812

2,394,664 2,395,812

ribosomal protein S1P family (according to Swiss-Prot)

bacterial [SW|ribosomal protein] bS1 family (single member, according to UniProt)

[PDB|5X8R] (chloroplast, small ribosomal subunit, 37% identity to aa 14 .. 266)

[PDB|1SRO] (S1 RNA-binding domain, 37% identity to aa 185 ... 343)

[PDB|5X8R] (chloroplast, small ribosomal subunit, 37% identity to aa 14 .. 266) [pubmed|28582576]

[PDB|1SRO] (E. coli S1 RNA-binding domain, 37% identity to aa 185 ... 343) [pubmed|9008164]

BKE22880 (Δ[[gene|ypfD]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC

BKK22880 (Δ[[gene|ypfD]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC

BKE22880 ([[gene|ypfD]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC

BKK22880 ([[gene|ypfD]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC

17218307, 20525796, 23002217, 15378759, 28516784

17218307, 20525796, 23002217, 15378759, 28516784, 28582576, 9008164, 7704259

4 reiterated [SW|S1 domain]s (aa 16-84, aa 102-167, aa 188-256, aa 273-342) (according to UniProt)